| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-03 05:10:01 |
| Analysis completed | 2025-04-03 05:10:01 |
| Wall time | 0:0:0 hours |
| locus | COI |
| preliminary_id | Pseudococcus |
| taxa_of_interest |
Pseudococcus |
| country | Australia |
| host | Causonis trifolia |
| sample_id | MG220521_3 |
| Query DNA sequence |
>MG220521_3 ATCATAAAAATATCAGAATAATATATTTAATATTTGGATTTTGATCAGGATTAATAGGTT TATCAATAAGTTTTATTATTCGTATTGAATTAATAAATTTAAATAATAACTTTAATAATA ATATAATTTACTATATAATAATTACTATCCATGCTTTTATTATAATTTTCTTTATAACTA TACCTATTATTATTGGAAGATTAAGAAACTGACTTTTACCATTAATATTAATATCATCAG ATTTAATTTTCCCACGTTTAAATAATTTTAGATTTTGATTACTTATACCATCATTAATTT TTATAATATTAAATATATTATTAAATAATAATATTAATACTGGATGAACTCTTTATCCTC CTTTAATTAATCAAAATTTTATCACATTAAATTTTATTATTTTTTCTTTACATTTAAATG GAATCTCTTCAATTTTTAGATCTATTAATTTTATTTCATCAATTTTTATTATTAATAATA ATAATTTTTTATTAAATAATTTATCACTATATATTTGATCAATTATTATCACTACTATTT TATTAATTATTTCTATTCCTATTTTATCCAGAGCAATTACTATAATCATTTTAGATAATA ACTTAAATATAAATTTTTTTAATCCTATAGGTAATGGCAATCCAATTTTATACCAACATT TATTTTGATTTTTTGGACAT
Inconclusive
The analyst should attempt subjective species identification at the genus level.
Reasoning - Flag 1D:
At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%).
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1D) |
|
| Taxa of interest ruled out | False |
|
Flag 2B: Taxon of interest detected Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2C: ≤10% of taxon have reference sequence(s) at the given locus |
|
Flag 1D:
The analyst should attempt subjective species identification at the genus level
At least one candidate species matched with moderate stringency (identity ≥93.5% and <98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 0 | 0 |
| MODERATE MATCH | ≥ 93.5% | 30 | 6 |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|---|---|---|
| Pseudococcus longispinus | 25 | 96.5% | 0.0 |
| Pseudococcus nr. longispinus DSPKJ168-09 | 1 | 95.19999999999999% | 0.0 |
| Pseudococcus sp. MJMB-00146 | 1 | 95.0% | 0.0 |
| Pseudococcus nr. longispinus DSPKJ169-09 | 1 | 94.89999999999999% | 0.0 |
| Pseudococcus nr. longispinus DSPKJ140-09 | 1 | 94.89999999999999% | 0.0 |
| Delottococcus aberiae | 1 | 93.7% | 0.0 |
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | HM474381 | Pseudococcus longispinus voucher P1184 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 580.0 | 0.00e+00 | 96.5% |
| 2 | KY372546 | Pseudococcus longispinus voucher HM474381 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 580.0 | 0.00e+00 | 96.5% |
| 3 | KY372759 | Pseudococcus longispinus voucher MJMB-00069 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 577.0 | 0.00e+00 | 96.3% |
| 4 | KY372558 | Pseudococcus longispinus voucher HM474383 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 643 | 94.6% | 571.0 | 0.00e+00 | 96.3% |
| 5 | KY372470 | Pseudococcus longispinus voucher HM474382 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 643 | 94.6% | 571.0 | 0.00e+00 | 96.3% |
| 6 | HM474382 | Pseudococcus longispinus voucher P1165-3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 643 | 94.6% | 571.0 | 0.00e+00 | 96.3% |
| 7 | KY372464 | Pseudococcus longispinus voucher HM474385 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 92.1% | 557.0 | 0.00e+00 | 96.3% |
| 8 | HM474385 | Pseudococcus longispinus voucher P1165 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 92.1% | 557.0 | 0.00e+00 | 96.3% |
| 9 | HM474384 | Pseudococcus longispinus voucher P1165-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 86.8% | 523.0 | 0.00e+00 | 96.1% |
| 10 | KY372782 | Pseudococcus longispinus voucher HM474384 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 86.8% | 523.0 | 0.00e+00 | 96.1% |
| 11 | KY373111 | Pseudococcus longispinus voucher MJMB-00663 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 571.0 | 0.00e+00 | 96.0% |
| 12 | KY372973 | Pseudococcus longispinus voucher HM474375 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 568.0 | 0.00e+00 | 95.8% |
| 13 | KY373106 | Pseudococcus longispinus voucher HM474377 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 568.0 | 0.00e+00 | 95.8% |
| 14 | HM474374 | Pseudococcus longispinus voucher P1061 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 568.0 | 0.00e+00 | 95.8% |
| 15 | KY372448 | Pseudococcus longispinus voucher HM474386 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 568.0 | 0.00e+00 | 95.8% |
| 16 | KY372774 | Pseudococcus longispinus voucher HM474376 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 568.0 | 0.00e+00 | 95.8% |
| 17 | KY372655 | Pseudococcus longispinus voucher HM474378 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 568.0 | 0.00e+00 | 95.8% |
| 18 | KY373078 | Pseudococcus longispinus voucher HM474374 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 568.0 | 0.00e+00 | 95.8% |
| 19 | HM474380 | Pseudococcus longispinus voucher P1178-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 566.0 | 0.00e+00 | 95.8% |
| 20 | KY372854 | Pseudococcus longispinus voucher HM474380 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 566.0 | 0.00e+00 | 95.8% |
| 21 | KY372512 | Pseudococcus longispinus voucher HM474379 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 95.0% | 565.0 | 0.00e+00 | 95.8% |
| 22 | HM474379 | Pseudococcus longispinus voucher P1178-3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 95.0% | 565.0 | 0.00e+00 | 95.8% |
| 23 | KY372611 | Pseudococcus longispinus voucher MJMB-p1061 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 93.2% | 553.0 | 0.00e+00 | 95.7% |
| 24 | KU296036 | Pseudococcus longispinus voucher NBAIR/MB/PSL/05 cytochrome c oxidase subunit 1 (COX1) gene, partial cds; mitochondrial | 649 | 95.4% | 559.0 | 0.00e+00 | 95.4% |
| 25 | KP692680 | Pseudococcus longispinus isolate S3-800a cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 575.0 | 0.00e+00 | 95.2% |
| 26 | HM474390 | Pseudococcus nr. longispinus DSPKJ168-09 voucher P1105 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 556.0 | 0.00e+00 | 95.2% |
| 27 | KY372505 | Pseudococcus sp. MJMB-00146 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 93.5% | 540.0 | 0.00e+00 | 95.0% |
| 28 | HM474389 | Pseudococcus nr. longispinus DSPKJ169-09 voucher P1105-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 563.0 | 0.00e+00 | 94.9% |
| 29 | HM474391 | Pseudococcus nr. longispinus DSPKJ140-09 voucher P1132 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 550.0 | 0.00e+00 | 94.9% |
| 30 | KP771950 | Delottococcus aberiae voucher 12385 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 678 | 99.7% | 550.0 | 0.00e+00 | 93.7% |
| 31 | KP771957 | Delottococcus aberiae voucher 14269 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 648 | 95.3% | 520.0 | 0.00e+00 | 93.4% |
| 32 | KP771956 | Delottococcus aberiae voucher 12426 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 676 | 99.4% | 542.0 | 0.00e+00 | 93.3% |
| 33 | KP771958 | Delottococcus aberiae voucher 14266 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 649 | 95.4% | 518.0 | 0.00e+00 | 93.2% |
| 34 | KP692538 | Trionymus multivorus isolate S4-251 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 533.0 | 0.00e+00 | 93.1% |
| 35 | KP692579 | Paracoccus marginatus isolate S3-668 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 96.5% | 518.0 | 0.00e+00 | 93.0% |
| 36 | PQ567080 | Paracoccus marginatus isolate 5-CM cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 651 | 95.7% | 513.0 | 0.00e+00 | 92.9% |
| 37 | KY372987 | Paracoccus marginatus voucher HM474239 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 38 | KY372921 | Paracoccus marginatus voucher MJMB-00616 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 39 | MG437495 | Paracoccus marginatus voucher gx27 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 40 | MN901467 | Paracoccus marginatus voucher HNSY-PA-171 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 41 | KY372893 | Paracoccus marginatus voucher HM474242 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 42 | MG437487 | Paracoccus marginatus voucher gx10 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 43 | KY372674 | Paracoccus marginatus voucher MJMB-00679 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 44 | MG437484 | Paracoccus marginatus voucher gx07 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 45 | KY372753 | Paracoccus marginatus voucher MJMB-00694 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 46 | KY372990 | Paracoccus marginatus voucher MJMB-1400007 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 47 | KY373039 | Paracoccus marginatus voucher MJMB-00676 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 48 | KY373043 | Paracoccus marginatus voucher HM474240 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 49 | KY373063 | Paracoccus marginatus voucher MJMB-00120 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 50 | KY372810 | Paracoccus marginatus voucher HM474243 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 51 | KY372993 | Paracoccus marginatus voucher HM474244 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 52 | MG437482 | Paracoccus marginatus voucher gx05 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 53 | HM474238 | Paracoccus marginatus voucher P1191 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 54 | KY372568 | Paracoccus marginatus voucher MJMB-00682 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 55 | KY372567 | Paracoccus marginatus voucher MJMB-00134 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 56 | KY372574 | Paracoccus marginatus voucher HM474238 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 57 | MG437490 | Paracoccus marginatus voucher gx13 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 58 | MG437488 | Paracoccus marginatus voucher gx11 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 59 | KY372629 | Paracoccus marginatus voucher HM474241 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 60 | KY372920 | Paracoccus marginatus voucher MJMB-00645 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 61 | MG437491 | Paracoccus marginatus voucher gx14 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 507.0 | 0.00e+00 | 92.9% |
| 62 | KY373069 | Paracoccus marginatus voucher MJMB-00724 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 93.1% | 498.0 | 0.00e+00 | 92.9% |
| 63 | KY373146 | Paracoccus marginatus voucher MJMB-00761 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 495.0 | 0.00e+00 | 92.9% |
| 64 | KY372942 | Paracoccus marginatus voucher MJMB-00652 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 495.0 | 0.00e+00 | 92.9% |
| 65 | KY372716 | Paracoccus marginatus voucher MJMB-00644 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 495.0 | 0.00e+00 | 92.9% |
| 66 | KY372994 | Paracoccus marginatus voucher MJMB-00618 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 495.0 | 0.00e+00 | 92.9% |
| 67 | MK213581 | Paracoccus marginatus isolate BS_4_2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 623 | 91.6% | 491.0 | 0.00e+00 | 92.9% |
| 68 | KY372586 | Paracoccus marginatus voucher MJMB-00617 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 622 | 91.5% | 490.0 | 0.00e+00 | 92.9% |
| 69 | PV056693 | Paracoccus marginatus isolate F00106A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 618 | 90.9% | 486.0 | 0.00e+00 | 92.9% |
| 70 | KP031703 | Paracoccus marginatus isolate S3_685 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 618 | 90.9% | 486.0 | 0.00e+00 | 92.9% |
| 71 | KP692537 | Trionymus multivorus isolate S3-614 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 527.0 | 0.00e+00 | 92.8% |
| 72 | PQ567076 | Paracoccus marginatus isolate 1-WC cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 97.9% | 522.0 | 0.00e+00 | 92.8% |
| 73 | MT707297 | Paracoccus marginatus voucher A12 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 520.0 | 0.00e+00 | 92.8% |
| 74 | MT707298 | Paracoccus marginatus voucher A13 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 520.0 | 0.00e+00 | 92.8% |
| 75 | MT707299 | Paracoccus marginatus voucher A15 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 520.0 | 0.00e+00 | 92.8% |
| 76 | MT707300 | Paracoccus marginatus voucher A31 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 520.0 | 0.00e+00 | 92.8% |
| 77 | KY372642 | Paracoccus marginatus voucher MJMB-00641 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 94.0% | 501.0 | 0.00e+00 | 92.8% |
| 78 | KY373105 | Paracoccus marginatus voucher MJMB-00661 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 93.8% | 500.0 | 0.00e+00 | 92.8% |
| 79 | KY372998 | Paracoccus marginatus voucher MJMB-00633 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 93.5% | 498.0 | 0.00e+00 | 92.8% |
| 80 | KY372736 | Paracoccus marginatus voucher MJMB-00619 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 91.8% | 489.0 | 0.00e+00 | 92.8% |
| 81 | KY373093 | Paracoccus marginatus voucher MJMB-00620 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 91.8% | 489.0 | 0.00e+00 | 92.8% |
| 82 | KY372509 | Paracoccus marginatus voucher MJMB-00646 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 91.6% | 488.0 | 0.00e+00 | 92.8% |
| 83 | KY372992 | Paracoccus marginatus voucher MJMB-00690 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 91.6% | 488.0 | 0.00e+00 | 92.8% |
| 84 | KY372894 | Paracoccus marginatus voucher MJMB-00627 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 91.3% | 486.0 | 0.00e+00 | 92.8% |
| 85 | KY372906 | Paracoccus marginatus voucher MJMB-00725 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 90.4% | 483.0 | 0.00e+00 | 92.8% |
| 86 | PV056714 | Paracoccus marginatus isolate F00172C cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 483.0 | 0.00e+00 | 92.8% |
| 87 | KY372946 | Paracoccus marginatus voucher MJMB-00283 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 90.3% | 482.0 | 0.00e+00 | 92.8% |
| 88 | KY372800 | Paracoccus marginatus voucher MJMB-00625 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 90.3% | 482.0 | 0.00e+00 | 92.8% |
| 89 | MK213582 | Paracoccus marginatus isolate BS_4_3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 612 | 90.0% | 480.0 | 0.00e+00 | 92.8% |
| 90 | PV056695 | Paracoccus marginatus isolate F00110A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 612 | 90.0% | 480.0 | 0.00e+00 | 92.8% |
| 91 | PV056706 | Paracoccus marginatus isolate F00120A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 609 | 89.6% | 477.0 | 0.00e+00 | 92.8% |
| 92 | MK213583 | Paracoccus marginatus isolate BS_4_13 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 607 | 89.3% | 475.0 | 0.00e+00 | 92.8% |
| 93 | KY211605 | Paracoccus marginatus isolate S3-715 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 524.0 | 0.00e+00 | 92.7% |
| 94 | PQ567078 | Paracoccus marginatus isolate 3-WC cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 669 | 98.4% | 522.0 | 0.00e+00 | 92.7% |
| 95 | KY372995 | Paracoccus marginatus voucher MJMB-00675 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 504.0 | 0.00e+00 | 92.7% |
| 96 | KY372764 | Paracoccus marginatus voucher MJMB-1400008 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 91.2% | 485.0 | 0.00e+00 | 92.7% |
| 97 | PV056712 | Paracoccus marginatus isolate F00160B cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 603 | 88.7% | 471.0 | 0.00e+00 | 92.7% |
| 98 | PQ567077 | Paracoccus marginatus isolate 2-DF cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 665 | 97.8% | 518.0 | 0.00e+00 | 92.6% |
| 99 | PV056732 | Paracoccus marginatus isolate F00051A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 597 | 87.8% | 465.0 | 0.00e+00 | 92.6% |
| 100 | PQ567079 | Paracoccus marginatus isolate 4-CM cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 642 | 94.4% | 498.0 | 0.00e+00 | 92.5% |
| 101 | KY373167 | Pseudococcus comstocki voucher MJMB-00755 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 92.2% | 486.0 | 0.00e+00 | 92.5% |
| 102 | KY372910 | Pseudococcus comstocki voucher MJMB-00634 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 88.5% | 467.0 | 0.00e+00 | 92.5% |
| 103 | KP692683 | Pseudococcus odermatti isolate S3-188 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 518.0 | 0.00e+00 | 92.4% |
| 104 | KY373062 | Pseudococcus comstocki voucher MJMB-00754 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.9% | 488.0 | 0.00e+00 | 92.4% |
| 105 | KP771953 | Delottococcus confusus voucher 12431 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 677 | 99.6% | 522.0 | 0.00e+00 | 92.3% |
| 106 | KP692667 | Pseudococcus comstocki isolate S4-151 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 515.0 | 0.00e+00 | 92.3% |
| 107 | KP692685 | Pseudococcus odermatti isolate S3-212 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 515.0 | 0.00e+00 | 92.3% |
| 108 | KY373114 | Pseudococcidae sp. MJMB-00R16 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 93.7% | 489.0 | 0.00e+00 | 92.3% |
| 109 | KP771952 | Delottococcus confusus voucher 12395 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 670 | 98.5% | 515.0 | 0.00e+00 | 92.2% |
| 110 | PQ569631 | Planococcus citri isolate 3-CJ cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 641 | 94.3% | 491.0 | 0.00e+00 | 92.2% |
| 111 | LC785411 | Planococcus citri personal:Fatemeh Hosseininaveh:4-Vru-K-Pl_ci-2020 mitochondrial DNA, similar to cytochrome c oxidase subunit 1, partial sequence | 637 | 93.7% | 487.0 | 0.00e+00 | 92.2% |
| 112 | LC785410 | Planococcus citri personal:Fatemeh Hosseininaveh:3-Vru-K-Pl_ci-2020 mitochondrial DNA, similar to cytochrome c oxidase subunit 1, partial sequence | 635 | 93.4% | 485.0 | 0.00e+00 | 92.2% |
| 113 | KP981091 | Pseudococcus comstocki isolate wfsys022 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 99.0% | 514.0 | 0.00e+00 | 92.1% |
| 114 | KP692665 | Pseudococcus comstocki isolate S3-620 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 512.0 | 0.00e+00 | 92.1% |
| 115 | KP692668 | Pseudococcus comstocki isolate S4-325 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 512.0 | 0.00e+00 | 92.1% |
| 116 | MN901459 | Pseudococcus cryptus voucher HNSY-BP-161 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 647 | 95.1% | 494.0 | 0.00e+00 | 92.1% |
| 117 | KY372663 | Pseudococcus sp. MJMB-00R50 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 494.0 | 0.00e+00 | 92.1% |
| 118 | KY372479 | Pseudococcus sp. MJMB-00R10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 635 | 93.4% | 485.0 | 0.00e+00 | 92.1% |
| 119 | KY372821 | Planococcus citri voucher MJMB-00001 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 93.2% | 484.0 | 0.00e+00 | 92.1% |
| 120 | KY372496 | Planococcus citri voucher MJMB-00740 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.9% | 482.0 | 0.00e+00 | 92.1% |
| 121 | KY372516 | Planococcus citri voucher MJMB-00R19 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.9% | 482.0 | 0.00e+00 | 92.1% |
| 122 | KY372602 | Planococcus citri voucher MJMB-00762 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 92.8% | 481.0 | 0.00e+00 | 92.1% |
| 123 | KY372732 | Pseudococcus sp. MJMB-00R52 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 92.5% | 479.0 | 0.00e+00 | 92.1% |
| 124 | OP381576 | Planococcus citri voucher personal collection:Pablo Oliveira:SDN138 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 468.0 | 0.00e+00 | 92.1% |
| 125 | OP381575 | Planococcus citri voucher personal collection:Pablo Oliveira:ST133 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 468.0 | 0.00e+00 | 92.1% |
| 126 | KY211618 | Pseudococcus comstocki isolate S5-405 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 676 | 99.4% | 514.0 | 0.00e+00 | 92.0% |
| 127 | KP692666 | Pseudococcus comstocki isolate S3-623 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 509.0 | 0.00e+00 | 92.0% |
| 128 | KP692670 | Pseudococcus cryptus isolate S3-649 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 509.0 | 0.00e+00 | 92.0% |
| 129 | PQ569954 | Pseudococcus cryptus isolate 1-SY cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 651 | 95.7% | 495.0 | 0.00e+00 | 92.0% |
| 130 | KY372859 | Pseudococcus comstocki voucher HM474364 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 131 | KY372548 | Pseudococcus comstocki voucher HM474355 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 132 | KY372745 | Pseudococcus comstocki voucher HM474354 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 133 | KY373034 | Pseudococcus comstocki voucher HM474357 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 134 | HM474352 | Pseudococcus comstocki voucher 20070233 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 135 | KY372830 | Pseudococcus comstocki voucher HM474360 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 136 | KY372915 | Pseudococcus comstocki voucher HM474356 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 137 | KY372824 | Pseudococcus comstocki voucher HM474367 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 138 | KY373015 | Pseudococcus sp. MJMB-00145 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 139 | KY372433 | Pseudococcus comstocki voucher HM474366 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 140 | KY372445 | Pseudococcus comstocki voucher HM474361 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 141 | KY372630 | Pseudococcus comstocki voucher HM474353 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 142 | KY372673 | Pseudococcus comstocki voucher HM474352 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 491.0 | 0.00e+00 | 92.0% |
| 143 | KY372449 | Pseudococcus sp. MJMB-00722 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 93.2% | 481.0 | 0.00e+00 | 92.0% |
| 144 | KY373101 | Pseudococcus comstocki voucher MJMB-p1017 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 91.8% | 474.0 | 0.00e+00 | 92.0% |
| 145 | KY372545 | Planococcus citri voucher MJMB-00R89 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 91.8% | 474.0 | 0.00e+00 | 92.0% |
| 146 | KY372555 | Planococcus citri voucher MJMB-00R45 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 91.8% | 474.0 | 0.00e+00 | 92.0% |
| 147 | KY372866 | Planococcus citri voucher MJMB-00639 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 91.6% | 473.0 | 0.00e+00 | 92.0% |
| 148 | KY372860 | Planococcus citri voucher MJMB-00259 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 90.1% | 466.0 | 0.00e+00 | 92.0% |
| 149 | KY372528 | Planococcus citri voucher MJMB-1301412 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 90.1% | 466.0 | 0.00e+00 | 92.0% |
| 150 | PQ569955 | Pseudococcus cryptus isolate 2-BA cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 669 | 98.4% | 507.0 | 0.00e+00 | 91.9% |
| 151 | KY372883 | Pseudococcus comstocki voucher HM474362 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 503.0 | 0.00e+00 | 91.9% |
| 152 | HM474362 | Pseudococcus comstocki voucher 2007-0234-06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 503.0 | 0.00e+00 | 91.9% |
| 153 | MT707315 | Planococcus minor voucher A16 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 502.0 | 0.00e+00 | 91.9% |
| 154 | MT707324 | Pseudococcus cryptus voucher A35 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 502.0 | 0.00e+00 | 91.9% |
| 155 | KY372706 | Pseudococcus comstocki voucher MJMB-20070233-4 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 94.0% | 483.0 | 0.00e+00 | 91.9% |
| 156 | LC785413 | Planococcus ficus personal:Fatemeh Hosseininaveh:6-Vru-K-Pl_fi-2021 mitochondrial DNA, similar to cytochrome c oxidase subunit 1, partial sequence | 637 | 93.7% | 481.0 | 0.00e+00 | 91.9% |
| 157 | LC121494 | Planococcus minor mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 631 | 92.8% | 478.0 | 0.00e+00 | 91.9% |
| 158 | KY372472 | Planococcus citri voucher MJMB-00R31 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 477.0 | 0.00e+00 | 91.9% |
| 159 | KY372977 | Pseudococcus sp. MJMB-00R80 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 477.0 | 0.00e+00 | 91.9% |
| 160 | PQ569956 | Pseudococcus cryptus isolate 3-SY cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 630 | 92.6% | 477.0 | 0.00e+00 | 91.9% |
| 161 | KY372561 | Pseudococcus sp. MJMB-00239 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 619 | 91.0% | 469.0 | 0.00e+00 | 91.9% |
| 162 | KY372812 | Pseudococcus comstocki voucher MJMB-20050045 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 618 | 90.9% | 468.0 | 0.00e+00 | 91.9% |
| 163 | OP381585 | Planococcus citri voucher personal collection:Pablo Oliveira:RIVE175.1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 164 | OP381596 | Planococcus citri voucher personal collection:Pablo Oliveira:RE193 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 165 | OP381535 | Planococcus citri voucher personal collection:Pablo Oliveira:NVEN14 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 166 | OP381560 | Planococcus citri voucher personal collection:Pablo Oliveira:BSF102 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 167 | OP381513 | Planococcus citri voucher personal collection:Pablo Oliveira:VVAL26 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 168 | OP381523 | Planococcus citri voucher personal collection:Pablo Oliveira:AGBR51 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 169 | OP381533 | Planococcus citri voucher personal collection:Pablo Oliveira:NVEN7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 170 | OP381597 | Planococcus citri voucher personal collection:Pablo Oliveira:RE194 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 171 | OP381518 | Planococcus citri voucher personal collection:Pablo Oliveira:SDN31 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 172 | OP381577 | Planococcus citri voucher personal collection:Pablo Oliveira:SDN140.2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 173 | OP381556 | Planococcus citri voucher personal collection:Pablo Oliveira:ABRA94 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 174 | OP381554 | Planococcus citri voucher personal collection:Pablo Oliveira:ABRA91 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 175 | OP381588 | Planococcus citri voucher personal collection:Pablo Oliveira:RE185 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 176 | OP381586 | Planococcus citri voucher personal collection:Pablo Oliveira:RE182 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 177 | OP381590 | Planococcus citri voucher personal collection:Pablo Oliveira:RE187 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 178 | OP381557 | Planococcus citri voucher personal collection:Pablo Oliveira:ABRA97 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 179 | OP381508 | Planococcus citri voucher personal collection:Pablo Oliveira:SMAT2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 180 | OP381545 | Planococcus citri voucher personal collection:Pablo Oliveira:AGBR50 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 181 | OP381587 | Planococcus citri voucher personal collection:Pablo Oliveira:RE183 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 182 | OP381580 | Planococcus citri voucher personal collection:Pablo Oliveira:SRC150 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 183 | OP381581 | Planococcus citri voucher personal collection:Pablo Oliveira:BA161 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 184 | OP381517 | Planococcus citri voucher personal collection:Pablo Oliveira:SDN30 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 185 | OP381504 | Planococcus citri voucher personal collection:Pablo Oliveira:NVEN70 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 186 | OP381510 | Planococcus citri voucher personal collection:Pablo Oliveira:NVEN8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 187 | OP381594 | Planococcus citri voucher personal collection:Pablo Oliveira:RE191 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 188 | OP381598 | Planococcus citri voucher personal collection:Pablo Oliveira:RE195 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 189 | OP381546 | Planococcus citri voucher personal collection:Pablo Oliveira:AGBR48 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 190 | OP381544 | Planococcus citri voucher personal collection:Pablo Oliveira:AGBR46 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 191 | OP381519 | Planococcus citri voucher personal collection:Pablo Oliveira:VPAV37 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 192 | OP381595 | Planococcus citri voucher personal collection:Pablo Oliveira:RE192 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 193 | OP381578 | Planococcus citri voucher personal collection:Pablo Oliveira:SM146 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 194 | OP381512 | Planococcus citri voucher personal collection:Pablo Oliveira:JAG20 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 195 | OP381534 | Planococcus citri voucher personal collection:Pablo Oliveira:NVEN10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 196 | OP381520 | Planococcus citri voucher personal collection:Pablo Oliveira:SGP44 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 197 | OP381562 | Planococcus citri voucher personal collection:Pablo Oliveira:CL105 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 198 | OP381509 | Planococcus citri voucher personal collection:Pablo Oliveira:BESP5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 199 | OP381547 | Planococcus citri voucher personal collection:Pablo Oliveira:AGBR53 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 200 | OP381550 | Planococcus citri voucher personal collection:Pablo Oliveira:LIND59 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 201 | OP381539 | Planococcus citri voucher personal collection:Pablo Oliveira:VVAL25 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 202 | OP381505 | Planococcus citri voucher personal collection:Pablo Oliveira:ALE4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 465.0 | 0.00e+00 | 91.9% |
| 203 | KY211606 | Planococcus minor isolate S4-031 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 677 | 99.6% | 509.0 | 0.00e+00 | 91.8% |
| 204 | KP692638 | Planococcus citri isolate S3-185 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 506.0 | 0.00e+00 | 91.8% |
| 205 | PQ569630 | Planococcus citri isolate 2-SY cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 97.9% | 501.0 | 0.00e+00 | 91.8% |
| 206 | ON811688 | Planococcus minor voucher NBAIR-MB-Gt002 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 658 | 96.8% | 496.0 | 0.00e+00 | 91.8% |
| 207 | PQ568025 | Planococcus minor isolate 3-SY cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 655 | 96.3% | 493.0 | 0.00e+00 | 91.8% |
| 208 | KX015100 | Planococcus minor voucher 4504001ZJ1600090 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 488.0 | 0.00e+00 | 91.8% |
| 209 | PQ568023 | Planococcus minor isolate 1-WZS cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 642 | 94.4% | 483.0 | 0.00e+00 | 91.8% |
| 210 | KY373182 | Planococcus minor voucher MJMB-00R55 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 635 | 93.4% | 479.0 | 0.00e+00 | 91.8% |
| 211 | KY372861 | Planococcus minor voucher MJMB-000R7 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 93.1% | 477.0 | 0.00e+00 | 91.8% |
| 212 | KY372930 | Planococcus minor voucher MJMB-00712 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 93.1% | 477.0 | 0.00e+00 | 91.8% |
| 213 | KY373103 | Planococcus minor voucher MJMB-00214 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.9% | 476.0 | 0.00e+00 | 91.8% |
| 214 | KY373045 | Planococcus minor voucher MJMB-00758 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 632 | 92.9% | 476.0 | 0.00e+00 | 91.8% |
| 215 | KY373030 | Planococcus citri voucher MJMB-00R38 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 474.0 | 0.00e+00 | 91.8% |
| 216 | KY372925 | Planococcus minor voucher MJMB-p1068 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 474.0 | 0.00e+00 | 91.8% |
| 217 | KY372510 | Planococcus minor voucher MJMB-00R47 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 618 | 90.9% | 465.0 | 0.00e+00 | 91.8% |
| 218 | OP425688 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE223 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 219 | OP425679 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE214 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 220 | OP425680 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE215 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 221 | OP425678 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE213 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 222 | OP425691 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:CL107 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 223 | OP425686 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE221 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 224 | OP425685 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE220 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 225 | OP425677 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE212 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 226 | OP425683 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE218 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 227 | OP425689 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE225 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 228 | OP425682 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE217 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 229 | OP425687 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE222 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 230 | OP425681 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE216 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 231 | OP425690 | Ferrisia dasylirii voucher personal collection:Pablo Oliveira:RE226 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 613 | 90.1% | 464.0 | 0.00e+00 | 91.8% |
| 232 | KY211608 | Planococcus minor isolate S5-002A cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 676 | 99.4% | 508.0 | 0.00e+00 | 91.7% |
| 233 | KY211612 | Planococcus citri isolate S5-092 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 99.0% | 505.0 | 0.00e+00 | 91.7% |
| 234 | KP692657 | Planococcus minor isolate S3-645 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 503.0 | 0.00e+00 | 91.7% |
| 235 | KP692637 | Planococcus citri isolate S3-120 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 503.0 | 0.00e+00 | 91.7% |
| 236 | MT707321 | Planococcus minor voucher A51 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 499.0 | 0.00e+00 | 91.7% |
| 237 | MT707320 | Planococcus minor voucher A50 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 499.0 | 0.00e+00 | 91.7% |
| 238 | MT707319 | Planococcus minor voucher A44 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 499.0 | 0.00e+00 | 91.7% |
| 239 | MT707318 | Planococcus minor voucher A26 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 499.0 | 0.00e+00 | 91.7% |
| 240 | MT707317 | Planococcus minor voucher A23 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 499.0 | 0.00e+00 | 91.7% |
| 241 | MT707316 | Planococcus minor voucher A21 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 499.0 | 0.00e+00 | 91.7% |
| 242 | GU936932 | Pseudococcus comstocki cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 243 | KY372979 | Planococcus citri voucher MJMB-00643 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 244 | KY372939 | Planococcus citri voucher MJMB-00642 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 245 | KY372820 | Planococcus minor voucher MJMB-00135 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 246 | KY372784 | Planococcus minor voucher MJMB-00100 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 247 | KY373107 | Planococcus citri voucher HM474287 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 248 | KY372462 | Planococcus minor voucher MJMB-00183 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 249 | KY373108 | Planococcus citri voucher MJMB-00695 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 250 | KY372531 | Planococcus minor voucher MJMB-00716 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 251 | HM474286 | Planococcus citri voucher 2008-0001-2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 252 | KY372605 | Planococcus minor voucher MJMB-00713 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 253 | KY372556 | Planococcus minor voucher MJMB-00151 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 254 | KY373081 | Planococcus citri voucher MJMB-00774 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 255 | KY373051 | Planococcus citri voucher MJMB-00726 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 256 | KY372669 | Planococcus minor voucher MJMB-00140 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 257 | KY372596 | Planococcus minor voucher HM474313 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 258 | JF965419 | Planococcus minor cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 259 | HM474312 | Planococcus minor voucher P915-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 260 | KY373012 | Planococcus citri voucher MJMB-00R49 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 261 | KY372791 | Planococcus minor voucher MJMB-00154 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 262 | KY372564 | Planococcus minor voucher MJMB-00139 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 263 | KY372651 | Planococcus citri voucher MJMB-00660 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 264 | KY372495 | Planococcus minor voucher MJMB-00143 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 265 | KY372701 | Planococcus minor voucher MJMB-00130 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 266 | KY372884 | Planococcus minor voucher MJMB-00187 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 267 | MN901465 | Planococcus minor voucher HNWN-RU-171 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 268 | KY372926 | Planococcus minor voucher HM474317 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 269 | KY373075 | Pseudococcus comstocki voucher HM474368 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 270 | KY373004 | Planococcus minor voucher MJMB-00196 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 271 | KY372590 | Planococcus citri voucher HM474286 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 272 | KY372502 | Planococcus minor voucher HM474318 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 273 | KY372579 | Planococcus minor voucher MJMB-00121 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 274 | KY372622 | Planococcus minor voucher MJMB-00285 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 275 | KY372514 | Planococcus minor voucher MJMB-00150 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 276 | KY372949 | Planococcus minor voucher HM474315 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 277 | KY373094 | Planococcus minor voucher MJMB-00188 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 278 | KY373180 | Planococcus minor voucher HM474319 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 279 | KY372865 | Planococcus minor voucher MJMB-00707 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 280 | KY372744 | Planococcus minor voucher MJMB-00291 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 281 | MG437485 | Planococcus citri voucher gx08 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 282 | HM474368 | Pseudococcus comstocki voucher k162 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 283 | KY372583 | Planococcus citri voucher MJMB-00155 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 284 | KY372671 | Planococcus citri voucher MJMB-00R48 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 285 | KY372594 | Planococcus minor voucher MJMB-00288 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 286 | KY372814 | Planococcus minor voucher HM474316 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 287 | KY372871 | Planococcus citri voucher MJMB-00773 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 288 | KY372723 | Planococcus minor voucher HM474312 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 485.0 | 0.00e+00 | 91.7% |
| 289 | KY372896 | Planococcus minor voucher MJMB-p1095 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 635 | 93.4% | 476.0 | 0.00e+00 | 91.7% |
| 290 | KY372530 | Planococcus minor voucher HM474314 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 93.2% | 475.0 | 0.00e+00 | 91.7% |
| 291 | HM474314 | Planococcus minor voucher P1071-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 93.2% | 475.0 | 0.00e+00 | 91.7% |
| 292 | KY372679 | Planococcus minor voucher MJMB-00760 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 92.2% | 471.0 | 0.00e+00 | 91.7% |
| 293 | KY372659 | Planococcus minor voucher MJMB-00624 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 91.8% | 468.0 | 0.00e+00 | 91.7% |
| 294 | KY372899 | Planococcus citri voucher MJMB-00R59 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 91.6% | 467.0 | 0.00e+00 | 91.7% |
| 295 | OP654154 | Planococcus vovae voucher NMR cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 616 | 90.6% | 463.0 | 0.00e+00 | 91.7% |
| 296 | OP381567 | Planococcus citri voucher personal collection:Pablo Oliveira:CBA116 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 297 | OP391569 | Planococcus minor voucher personal collection:Pablo Oliveira:NVEN9 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 298 | OP381541 | Planococcus citri voucher personal collection:Pablo Oliveira:SGP41 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 299 | OP381529 | Planococcus citri voucher personal collection:Pablo Oliveira:ARN68 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 300 | OP381516 | Planococcus citri voucher personal collection:Pablo Oliveira:SDN29 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 301 | OP381579 | Planococcus citri voucher personal collection:Pablo Oliveira:SM147 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 302 | OP381570 | Planococcus citri voucher personal collection:Pablo Oliveira:MT125 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 303 | OP391581 | Planococcus minor voucher personal collection:Pablo Oliveira:NVI76 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 304 | OP381506 | Planococcus citri voucher personal collection:Pablo Oliveira:VIC5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 305 | OP381569 | Planococcus citri voucher personal collection:Pablo Oliveira:CBA118 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 306 | OP381553 | Planococcus citri voucher personal collection:Pablo Oliveira:ABRA90 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 307 | OP391586 | Planococcus minor voucher personal collection:Pablo Oliveira:LAV88 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 308 | OP381552 | Planococcus citri voucher personal collection:Pablo Oliveira:ABRA89 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 309 | OP381525 | Planococcus citri voucher personal collection:Pablo Oliveira:LIND61 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 310 | OP391583 | Planococcus minor voucher personal collection:Pablo Oliveira:LAV85 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 311 | OP391579 | Planococcus minor voucher personal collection:Pablo Oliveira:MUC73 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 312 | OP381551 | Planococcus citri voucher personal collection:Pablo Oliveira:ARN67 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 313 | OP381543 | Planococcus citri voucher personal collection:Pablo Oliveira:SGP39 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 314 | OP391572 | Planococcus minor voucher personal collection:Pablo Oliveira:LAV80 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 315 | OP381522 | Planococcus citri voucher personal collection:Pablo Oliveira:AGBR49 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 316 | OP381558 | Planococcus citri voucher personal collection:Pablo Oliveira:BSF98 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 317 | OP391589 | Planococcus minor voucher personal collection:Pablo Oliveira:JMON172 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 318 | OP391587 | Planococcus minor voucher personal collection:Pablo Oliveira:MT127 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 319 | OP381571 | Planococcus citri voucher personal collection:Pablo Oliveira:MT128 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 320 | OP381582 | Planococcus citri voucher personal collection:Pablo Oliveira:BA162 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 321 | OP381584 | Planococcus citri voucher personal collection:Pablo Oliveira:JMON164 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 322 | OP381536 | Planococcus citri voucher personal collection:Pablo Oliveira:JAG17 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 323 | OP381538 | Planococcus citri voucher personal collection:Pablo Oliveira:JAG22 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 324 | OP391593 | Planococcus minor voucher personal collection:Pablo Oliveira:RE229 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 615 | 90.4% | 462.0 | 0.00e+00 | 91.7% |
| 325 | KY372790 | Planococcus minor voucher HM474320 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 497.0 | 0.00e+00 | 91.6% |
| 326 | KY372948 | Planococcus citri voucher HM474278 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 497.0 | 0.00e+00 | 91.6% |
| 327 | HM474278 | Planococcus citri voucher P921-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 497.0 | 0.00e+00 | 91.6% |
| 328 | HM474320 | Planococcus minor voucher P1043-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 497.0 | 0.00e+00 | 91.6% |
| 329 | KY372519 | Planococcus citri voucher HM474279 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 497.0 | 0.00e+00 | 91.6% |
| 330 | KY372749 | Pseudococcus comstocki voucher HM474358 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 497.0 | 0.00e+00 | 91.6% |
| 331 | HM474358 | Pseudococcus comstocki voucher P1017-4-2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 497.0 | 0.00e+00 | 91.6% |
| 332 | PQ568024 | Planococcus minor isolate 2-LD cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 663 | 97.5% | 495.0 | 0.00e+00 | 91.6% |
| 333 | PQ569629 | Planococcus citri isolate 1-SY cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 651 | 95.7% | 486.0 | 0.00e+00 | 91.6% |
| 334 | HQ179883 | Ferrisia malvastra isolate P12021 cytochrome oxidase subunit I-like (COI) gene, partial sequence; mitochondrial | 644 | 94.7% | 481.0 | 0.00e+00 | 91.6% |
| 335 | KY372844 | Planococcus citri voucher HM474284 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 473.0 | 0.00e+00 | 91.6% |
| 336 | HM474284 | Planococcus citri voucher P1106 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 473.0 | 0.00e+00 | 91.6% |
| 337 | KY372833 | Planococcus minor voucher MJMB-00129 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 92.8% | 472.0 | 0.00e+00 | 91.6% |
| 338 | LC121496 | Pseudococcus comstocki mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 631 | 92.8% | 472.0 | 0.00e+00 | 91.6% |
| 339 | LC785412 | Planococcus ficus personal:Fatemeh Hosseininaveh:5-Vru-K-Pl_fi-2021 mitochondrial DNA, similar to cytochrome c oxidase subunit 1, partial sequence | 631 | 92.8% | 472.0 | 0.00e+00 | 91.6% |
| 340 | KY373077 | Planococcus citri voucher MJMB-00205 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 92.2% | 468.0 | 0.00e+00 | 91.6% |
| 341 | KP692658 | Planococcus minor isolate S3-646 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 500.0 | 0.00e+00 | 91.5% |
| 342 | KY372633 | Ferrisia malvastra voucher MJMB-p1202 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 483.0 | 0.00e+00 | 91.5% |
| 343 | KY372811 | Ferrisia malvastra voucher MJMB-00R51 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 483.0 | 0.00e+00 | 91.5% |
| 344 | KY372501 | Planococcus minor voucher HM474311 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 345 | KX015088 | Pseudococcus comstocki voucher 4504001ZJ1505460 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 95.3% | 482.0 | 0.00e+00 | 91.5% |
| 346 | KY372846 | Planococcus citri voucher MJMB-00650 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 347 | HM474285 | Planococcus citri voucher 2008-0156 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 348 | MG813768 | Planococcus citri voucher S0016B cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 349 | HM474311 | Planococcus minor voucher P927-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 350 | KX015091 | Planococcus minor voucher 4504001ZJ1500286 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 351 | KY372523 | Planococcus minor voucher MJMB-00340 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 352 | KX015106 | Planococcus minor voucher 4504001ZJ1600212c cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 353 | KY373073 | Planococcus citri voucher HM474285 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 354 | KY373090 | Planococcus minor voucher MJMB-00289 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 355 | KY372553 | Planococcus minor voucher MJMB-00331 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 482.0 | 0.00e+00 | 91.5% |
| 356 | KY372537 | Planococcus minor voucher MJMB-00093 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 92.6% | 468.0 | 0.00e+00 | 91.5% |
| 357 | KY372796 | Planococcus minor voucher MJMB-00141 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 91.6% | 464.0 | 0.00e+00 | 91.5% |
| 358 | KP771955 | Paracoccus burnerae voucher 12414 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 677 | 99.6% | 504.0 | 0.00e+00 | 91.4% |
| 359 | KP692645 | Planococcus citri isolate S4-004 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 497.0 | 0.00e+00 | 91.4% |
| 360 | LC121493 | Planococcus citri mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 662 | 97.4% | 491.0 | 0.00e+00 | 91.4% |
| 361 | MH253683 | Nipaecoccus bromelicola voucher CSCA 16V451 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 650 | 95.6% | 482.0 | 0.00e+00 | 91.4% |
| 362 | MH253684 | Nipaecoccus bromelicola voucher CSCA 16V452 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 650 | 95.6% | 482.0 | 0.00e+00 | 91.4% |
| 363 | MG813767 | Planococcus citri voucher S0016A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 479.0 | 0.00e+00 | 91.4% |
| 364 | MG813766 | Planococcus citri voucher S0015A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 479.0 | 0.00e+00 | 91.4% |
| 365 | KY372488 | Pseudococcus sp. MJMB-00221 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 640 | 94.1% | 474.0 | 0.00e+00 | 91.4% |
| 366 | HM474308 | Planococcus lilacinus voucher P1155-2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 491.0 | 0.00e+00 | 91.3% |
| 367 | KY372931 | Planococcus lilacinus voucher HM474308 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 491.0 | 0.00e+00 | 91.3% |
| 368 | KY372795 | Pseudococcidae sp. MJMB-00669 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 479.0 | 0.00e+00 | 91.3% |
| 369 | KY372447 | Pseudococcidae sp. MJMB-00651 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 479.0 | 0.00e+00 | 91.3% |
| 370 | KY372721 | Pseudococcidae sp. MJMB-00655 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 479.0 | 0.00e+00 | 91.3% |
| 371 | KY372419 | Planococcus lilacinus voucher HM474309 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 479.0 | 0.00e+00 | 91.3% |
| 372 | KY372636 | Pseudococcidae sp. MJMB-00653 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 479.0 | 0.00e+00 | 91.3% |
| 373 | MN306287 | Maconellicoccus multipori voucher 3576-PCO cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 479.0 | 0.00e+00 | 91.3% |
| 374 | KY372460 | Planococcus lilacinus voucher HM474310 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 479.0 | 0.00e+00 | 91.3% |
| 375 | HM474309 | Planococcus lilacinus voucher P1155-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 479.0 | 0.00e+00 | 91.3% |
| 376 | KY372739 | Pseudococcidae sp. MJMB-00671 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 479.0 | 0.00e+00 | 91.3% |
| 377 | KY372678 | Pseudococcidae sp. MJMB-00665 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 479.0 | 0.00e+00 | 91.3% |
| 378 | HM474188 | Hemiptera sp. DSPKJ161-09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 93.2% | 469.0 | 0.00e+00 | 91.3% |
| 379 | OX465514 | Planococcus citri genome assembly, organelle: mitochondrion | 680 | 100.0% | 1000.0 | 0.00e+00 | 91.2% |
| 380 | HM474283 | Planococcus citri voucher P1106-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 488.0 | 0.00e+00 | 91.2% |
| 381 | KY372534 | Planococcus citri voucher HM474288 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 488.0 | 0.00e+00 | 91.2% |
| 382 | KY373079 | Planococcus citri voucher HM474283 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 488.0 | 0.00e+00 | 91.2% |
| 383 | MH253682 | Nipaecoccus bromelicola voucher CSCA 16V450 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 662 | 97.4% | 488.0 | 0.00e+00 | 91.2% |
| 384 | MH253685 | Nipaecoccus bromelicola voucher CSCA 16V453 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 662 | 97.4% | 488.0 | 0.00e+00 | 91.2% |
| 385 | MG813759 | Planococcus citri voucher S0010E cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 386 | HM474187 | Hemiptera sp. DSPKJ162-09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 387 | MG813762 | Planococcus citri voucher S0013A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 388 | HM474280 | Planococcus citri voucher P1160-2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 389 | MN901456 | Planococcus citri voucher HNWZS-GF-151 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 390 | MG813757 | Planococcus citri voucher S0010C cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 391 | KY372958 | Pseudococcidae sp. MJMB-00680 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 476.0 | 0.00e+00 | 91.2% |
| 392 | MW929771 | Paracoccus burnerae voucher TFMC/HE-2141a cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 393 | MG813761 | Planococcus citri voucher S0012B cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 394 | KY372905 | Planococcus citri voucher HM474280 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 395 | MW929773 | Paracoccus burnerae voucher TFMC/HE-2141c cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 396 | KY372874 | Planococcus citri voucher HM474281 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 397 | MW929772 | Paracoccus burnerae voucher TFMC/HE-2141b cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 398 | GU936938 | Planococcus citri cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 476.0 | 0.00e+00 | 91.2% |
| 399 | OR825532 | Ferrisia virgata isolate Banana cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 662 | 97.4% | 485.0 | 0.00e+00 | 91.1% |
| 400 | PQ583146 | Ferrisia virgata isolate NBAIR-87B cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 662 | 97.4% | 485.0 | 0.00e+00 | 91.1% |
| 401 | LC278435 | Ferrisia virgata mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 662 | 97.4% | 485.0 | 0.00e+00 | 91.1% |
| 402 | MG813763 | Planococcus citri voucher S0013B cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 473.0 | 0.00e+00 | 91.1% |
| 403 | KY372598 | Pseudococcidae sp. MJMB-SK cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 94.0% | 468.0 | 0.00e+00 | 91.1% |
| 404 | MK086943 | Hypogeococcus pungens voucher CSCA 18B479 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 678 | 99.7% | 495.0 | 0.00e+00 | 91.0% |
| 405 | MK086951 | Hypogeococcus pungens voucher CSCA 18C037 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 675 | 99.3% | 492.0 | 0.00e+00 | 91.0% |
| 406 | MK086945 | Hypogeococcus pungens voucher CSCA 18B481 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 674 | 99.1% | 491.0 | 0.00e+00 | 91.0% |
| 407 | LC713217 | Crisicoccus azaleae mitochondrial COX1 gene for cytochrome c oxidase subunit 1, partial cds | 663 | 97.5% | 483.0 | 0.00e+00 | 91.0% |
| 408 | MH290556 | Nipaecoccus nipae complex sp. 1 SK-2018 voucher CSCA 17X976 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 657 | 96.6% | 480.0 | 0.00e+00 | 91.0% |
| 409 | MH290557 | Nipaecoccus nipae complex sp. 1 SK-2018 voucher CSCA 17X978 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 655 | 96.3% | 478.0 | 0.00e+00 | 91.0% |
| 410 | MH290544 | Nipaecoccus nipae complex sp. 1 SK-2018 voucher CSCA 16V545 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 654 | 96.2% | 477.0 | 0.00e+00 | 91.0% |
| 411 | KP692688 | Pseudococcus sp. S3-155a cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 488.0 | 0.00e+00 | 90.9% |
| 412 | KP692715 | Ferrisia virgata isolate S3-671 cytochrome oxidase subunit I-like (COI) gene, partial sequence; mitochondrial | 671 | 98.7% | 487.0 | 0.00e+00 | 90.9% |
| 413 | MK086947 | Hypogeococcus pungens voucher CSCA 18B970 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 669 | 98.4% | 486.0 | 0.00e+00 | 90.9% |
| 414 | MK086948 | Hypogeococcus pungens voucher CSCA 18B971 cytochrome c oxidase subunit I gene, partial cds; mitochondrial | 666 | 97.9% | 483.0 | 0.00e+00 | 90.9% |
| 415 | PQ568064 | Ferrisia virgata isolate 2-SY cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 96.6% | 479.0 | 0.00e+00 | 90.9% |
| 416 | KX966396 | Pseudococcus orchidicola strain Jeju_17 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 648 | 95.3% | 471.0 | 0.00e+00 | 90.9% |
| 417 | KY372885 | Planococcus sp. MJMB-00153 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 470.0 | 0.00e+00 | 90.9% |
| 418 | KY372831 | Tylococcus westwoodi voucher MJMB-1401399 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 470.0 | 0.00e+00 | 90.9% |
| 419 | KY372481 | Planococcus ficus voucher HM474292 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 470.0 | 0.00e+00 | 90.9% |
| 420 | KY372626 | Planococcus ficus voucher HM474293 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 470.0 | 0.00e+00 | 90.9% |
| 421 | KY372431 | Pseudococcus sp. MJMB-00162 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 470.0 | 0.00e+00 | 90.9% |
| 422 | KY372612 | Planococcus ficus voucher MJMB-p1201 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 470.0 | 0.00e+00 | 90.9% |
| 423 | MN901462 | Ferrisia virgata voucher HNDZ-SA-171 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 647 | 95.1% | 470.0 | 0.00e+00 | 90.9% |
| 424 | HM474292 | Planococcus ficus voucher P1201-2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 470.0 | 0.00e+00 | 90.9% |
| 425 | KY372918 | Balanococcus takahashii voucher HM474093 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 467.0 | 0.00e+00 | 90.8% |
| 426 | HM474093 | Balanococcus takahashii voucher 20090145-2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 467.0 | 0.00e+00 | 90.8% |
| 427 | KY372638 | Pseudococcus sp. MJMB-00174 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 95.3% | 467.0 | 0.00e+00 | 90.8% |
| 428 | KY372467 | Balanococcus takahashii voucher HM474094 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 467.0 | 0.00e+00 | 90.8% |
| 429 | MG813760 | Planococcus citri voucher S0012A cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 467.0 | 0.00e+00 | 90.8% |
| 430 | MT707326 | Saccharicoccus sacchari voucher A10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 478.0 | 0.00e+00 | 90.7% |
| 431 | ON469576 | Tridiscus sp. EP20210901 voucher FSCA EP20210901 v6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 96.5% | 473.0 | 0.00e+00 | 90.7% |
| 432 | KY372735 | Ferrisia virgata voucher MJMB-00199 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 433 | KY372966 | Ferrisia virgata voucher MJMB-000R5 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 434 | KY372643 | Ferrisia virgata voucher MJMB-00209 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 435 | KY372738 | Ferrisia virgata voucher MJMB-00R58 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 436 | KY372599 | Ferrisia virgata voucher MJMB-00200 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 437 | KY373135 | Ferrisia virgata voucher MJMB-00718 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 438 | KY372709 | Ferrisia virgata voucher MJMB-00715 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 439 | KY373016 | Ferrisia virgata voucher MJMB-00197 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 440 | KY372497 | Ferrisia virgata voucher MJMB-00615 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 441 | KY372853 | Ferrisia virgata voucher MJMB-00264 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 442 | KY372951 | Ferrisia virgata voucher MJMB-00142 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 443 | KY373143 | Ferrisia virgata voucher MJMB-00275 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 444 | KY372924 | Ferrisia virgata voucher MJMB-00R37 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 445 | KY372900 | Ferrisia virgata voucher MJMB-00721 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 446 | KY372881 | Ferrisia virgata voucher MJMB-00190 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 447 | KY373169 | Ferrisia virgata voucher MJMB-00123 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 448 | KY373118 | Ferrisia virgata voucher MJMB-00107 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 449 | KY372741 | Ferrisia virgata voucher MJMB-00186 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 450 | KY372680 | Ferrisia virgata voucher MJMB-00208 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 469.0 | 0.00e+00 | 90.7% |
| 451 | KX015107 | Dysmicoccus lepelleyi voucher 4504001ZJ1600424 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 465.0 | 0.00e+00 | 90.7% |
| 452 | KU254183 | Dysmicoccus lepelleyi voucher ZJ1508611 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 465.0 | 0.00e+00 | 90.7% |
| 453 | KY372443 | Exallomochlus hispidus voucher MJMB-00247 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 465.0 | 0.00e+00 | 90.7% |
| 454 | KY372554 | Exallomochlus hispidus voucher MJMB-00251 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 645 | 94.9% | 465.0 | 0.00e+00 | 90.7% |
| 455 | HQ179887 | Ferrisia virgata isolate P1171 cytochrome oxidase subunit I-like (COI) gene, partial sequence; mitochondrial | 644 | 94.7% | 463.0 | 0.00e+00 | 90.7% |
| 456 | KP692521 | Crisicoccus matsumotoi isolate S3-469 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 482.0 | 0.00e+00 | 90.6% |
| 457 | KP692520 | Crisicoccus matsumotoi isolate S3-381 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 482.0 | 0.00e+00 | 90.6% |
| 458 | KY372869 | Pseudococcidae sp. MJMB-00286 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 466.0 | 0.00e+00 | 90.6% |
| 459 | KY373080 | Ferrisia virgata voucher MJMB-00757 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 466.0 | 0.00e+00 | 90.6% |
| 460 | KY373064 | Planococcus ficus voucher HM474291 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 464.0 | 0.00e+00 | 90.6% |
| 461 | KY373017 | Planococcus ficus voucher MJMB-00070 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 464.0 | 0.00e+00 | 90.6% |
| 462 | HM474289 | Planococcus ficus voucher P1218-3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 464.0 | 0.00e+00 | 90.6% |
| 463 | KY373122 | Planococcus ficus voucher HM474289 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 464.0 | 0.00e+00 | 90.6% |
| 464 | KY372482 | Planococcus ficus voucher HM474290 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 464.0 | 0.00e+00 | 90.6% |
| 465 | KY372697 | Planococcus ficus voucher MJMB-00067 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 95.1% | 464.0 | 0.00e+00 | 90.6% |
| 466 | KP771954 | Delottococcus phylicus voucher 12401 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 674 | 99.1% | 483.0 | 0.00e+00 | 90.5% |
| 467 | KP692504 | Coccura convexa isolate S3-586a cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 479.0 | 0.00e+00 | 90.5% |
| 468 | KP692519 | Crisicoccus matsumotoi isolate S3-031 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 479.0 | 0.00e+00 | 90.5% |
| 469 | MT707325 | Saccharicoccus sacchari voucher A07 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 475.0 | 0.00e+00 | 90.5% |
| 470 | KY372461 | Crisicoccus matsumotoi voucher HM474122 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 95.3% | 462.0 | 0.00e+00 | 90.5% |
| 471 | KP692661 | Planococcus sp. S3-298a cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 476.0 | 0.00e+00 | 90.4% |
| 472 | KY372425 | Saccharicoccus sacchari voucher MJMB-1500019 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 649 | 95.4% | 463.0 | 0.00e+00 | 90.4% |
| 473 | PQ567098 | Maconellicoccus hirsutus isolate 1-WC cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 680 | 100.0% | 482.0 | 0.00e+00 | 90.3% |
| 474 | KY211615 | Maconellicoccus hirsutus isolate S5-113 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 677 | 99.6% | 479.0 | 0.00e+00 | 90.3% |
| 475 | KP981102 | Dysmicoccus lepelleyi isolate wfsys033 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 99.0% | 478.0 | 0.00e+00 | 90.3% |
| 476 | KP981087 | Pseudococcus jackbeardsleyi isolate wfsys018 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 99.0% | 478.0 | 0.00e+00 | 90.3% |
| 477 | KP692484 | Antonina pretiosa isolate S4-166a cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 476.0 | 0.00e+00 | 90.3% |
| 478 | KR340585 | Dysmicoccus lavandulae voucher 5690-5691 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 662 | 97.4% | 470.0 | 0.00e+00 | 90.3% |
| 479 | KR340584 | Dysmicoccus lavandulae voucher 9635 cytochrome oxidase subunit 1 gene, partial cds; mitochondrial | 662 | 97.4% | 470.0 | 0.00e+00 | 90.3% |
| 480 | PP442574 | Maconellicoccus hirsutus isolate NBAIR-79A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 680 | 100.0% | 479.0 | 0.00e+00 | 90.2% |
| 481 | KP981101 | Dysmicoccus lepelleyi isolate wfsys032 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 99.0% | 475.0 | 0.00e+00 | 90.2% |
| 482 | KP981103 | Dysmicoccus lepelleyi isolate wfsys034 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 99.0% | 475.0 | 0.00e+00 | 90.2% |
| 483 | KP692522 | Crisicoccus matsumotoi isolate S3-388 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 473.0 | 0.00e+00 | 90.2% |
| 484 | KP692528 | Crisicoccus matsumotoi isolate S4-292 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 473.0 | 0.00e+00 | 90.2% |
| 485 | HM474388 | Pseudococcus nr. comstocki DSPKJ028-09 voucher k20080102-1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 665 | 97.8% | 470.0 | 0.00e+00 | 90.2% |
| 486 | MT707295 | Maconellicoccus hirsutus voucher A42 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 469.0 | 0.00e+00 | 90.2% |
| 487 | MT755016 | Spilococcus mamillariae voucher CSCA 20H810 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 660 | 97.1% | 465.0 | 0.00e+00 | 90.2% |
| 488 | MT755015 | Spilococcus mamillariae voucher CSCA 20H809 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 660 | 97.1% | 465.0 | 0.00e+00 | 90.2% |
| 489 | MT755014 | Spilococcus mamillariae voucher CSCA 20H808 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 660 | 97.1% | 465.0 | 0.00e+00 | 90.2% |
| 490 | MT755017 | Spilococcus mamillariae voucher CSCA 20H811 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 660 | 97.1% | 465.0 | 0.00e+00 | 90.2% |
| 491 | MT707294 | Maconellicoccus hirsutus voucher A20 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 97.6% | 466.0 | 0.00e+00 | 90.1% |
| 492 | KP692527 | Crisicoccus matsumotoi isolate S4-285 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 470.0 | 0.00e+00 | 90.0% |
| 493 | KP692723 | Pseudococcus viburni isolate S3-223 cytochrome oxidase subunit I-like (COI) gene, partial sequence; mitochondrial | 671 | 98.7% | 469.0 | 0.00e+00 | 90.0% |
| 494 | OR659451 | Pseudococcus jackbeardsleyi voucher KAU-PJ1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 669 | 98.4% | 468.0 | 0.00e+00 | 90.0% |
| 495 | KP981090 | Pseudococcus comstocki isolate wfsys021 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 673 | 99.0% | 469.0 | 0.00e+00 | 89.9% |
| 496 | KP692483 | Antonina graminis isolate S4-261 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 671 | 98.7% | 467.0 | 0.00e+00 | 89.9% |
| 497 | KP692722 | Pseudococcus viburni isolate S3-050 cytochrome oxidase subunit I-like (COI) gene, partial sequence; mitochondrial | 671 | 98.7% | 466.0 | 0.00e+00 | 89.9% |
| 498 | PQ541519 | Dysmicoccus neobrevipes isolate NBAIR-86 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 678 | 99.7% | 468.0 | 0.00e+00 | 89.7% |
| 499 | KP875974 | Dysmicoccus brevipes isolate Taiwan cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 678 | 99.7% | 468.0 | 0.00e+00 | 89.7% |
| 500 | OR825537 | Dysmicoccus brevipes isolate Banana cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 678 | 99.7% | 465.0 | 0.00e+00 | 89.5% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the identity (%) of BLAST hits grouped by genus. Each data point shows the alignment identity between the query and matched reference sequence. The analyst may wish to use this to make a subjective genus-level identification for the sample.
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Pseudococcus | genus | Pseudococcus | Pseudococcus longispinus | HM474381 | 0.965 |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Preliminary ID
Taxa of interest
Database coverage
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 391 sequences in the reference database for Pseudococcus at the given locus COI.
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Database coverage
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 391 sequences in the reference database for Pseudococcus at the given locus COI.
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |